rs9972730 chr16:87384100 G>A
- Sequence
cctactgcgctaacgaggctgctc[G/A]gcgaccacttcgcgccgcggcttt
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
- ASB for transcription factors
- CREB1_HUMAN MNT_HUMAN ZN426_HUMAN GABPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | -0.01 | 1.51 | 1.87 | n/a | No Hit | |||
| MNT_HUMAN | 0.45 | 1.33 | 2.00 | n/a | n/a | |||
| ZN426_HUMAN | n/a | 1.87 | 2.00 | n/a | n/a | |||
| GABPA_HUMAN | 0.40 | 1.50 | 2.08 | n/a | No Hit | |||
| SMAD4_HUMAN | -1.50 | 1.84 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood