rs9973650 chr2:237471623 G>A
- Sequence
ctgggtccctcagcttgcagggtc[G/A]gccccagtaacctgctctggccag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) SK-N-SH (neuroblastoma) spleen hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.38 | 1.69 | 1.72 | |||
| SK-N-SH (neuroblastoma) | 2.00 | -2.27 | 1.33 | |||
| spleen | 2.09 | -2.33 | 1.33 | |||
| hepatocytes | 1.77 | -1.93 | 1.17 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | 2.08 | -1.99 | 1.33 |
Items per page:
1 – 5 of 10