rs9983409 chr21:31559109 C>G
- Sequence
tctgccaatcggagctgtcagggc[C/G]cctccgcctgcggcctcgggggcc
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.08 | -0.52 | 3.30 | |||
| foreskin keratinocyte | n/a | 0.84 | 2.17 |
Items per page:
1 – 2 of 2