rs10505477 chr8:127395198 A>G
- Sequence
cccttttctaaatcttcatctcca[A/G]ttaaggcttcctgtttgatagaca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.98 | 0.41 | 1.36 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP colorectal adenoma, colorectal adenoma (excluding hyperplasic), colorectal adenoma (including hyperplasic), colorectal cancer, colorectal tumors, neuroticism, ovarian cancer, prostate cancer, prostate cancer (non-advanced prostate cancer), prostate cancer aggressiveness
PheWAS abnormal loss of weight and underweight, abnormal results of function studies, acquired deformities of finger, acquired deformities of limbs, acquired spondylolisthesis, acute cystitis, acute prostatitis, agorophobia, social phobia, and panic disorder, aneurysm and dissection of heart, aneurysm of other specified artery, arterial embolism and thrombosis, atherosclerosis of native arteries of the extremities with intermittent claudication, benign neoplasm of bone and articular cartilage, benign neoplasm of colon, cancer of brain and nervous system, cancer of larynx, cancer of mouth, cancer of the lower gi tract, cardiac arrest, cardiac arrest & ventricular fibrillation, cellulitis and abscess of face, cerebral ischemia, chorioretinal scars, chronic lymphocytic thyroiditis, chronic lymphoid leukemia, colorectal cancer, congenital anomalies of great vessels, diseases of white blood cells, disturbances of sulphur-bearing amino-acid metabolism, dyspareunia, dysphagia, elevated c-reactive protein, elevated sedimentation rate, elevated white blood cell count, first degree av block, hyperbilirubinemia, hyperglyceridemia, inflammatory and toxic neuropathy, intracranial hemorrhage, joint effusions, lymphoid leukemia, mastoiditis, obstruction of bile duct, other disorders of intestine, other specified gastritis, pancreatic cancer, paralysis/spasm of vocal cords or larynx, personality disorders, premenstrual tension syndromes, prostate cancer, psychogenic and somatoform disorders, retinal detachment with retinal defect, retinal detachments and defects, secondary/extrinsic cardiomyopathies, senile dementia, spondylosis with myelopathy, suppurative and unspecified otitis media, symptomatic artificial menopause, symptoms associated with female genital organs, symptoms involving female genital tract, symptoms of the muscles, syncope and collapse, thyroiditis, torsion dystonia, transient cerebral ischemia, urinary obstruction, ventricular fibrillation & flutter