rs10875595 chr5:141320922 T>G
- Sequence
actcatcttttcgcgagaacttgt[T/G]tttccgggatggaaatgacagtgt
- ASB in cell types
- K562 (myelogenous leukemia) CD14+ monocytes GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- MORC2_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MORC2_HUMAN | 2.30 | -0.66 | 1.00 | n/a | n/a | |||
| STAT1_HUMAN | 2.48 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1/fvc ratio (in asthmatic participants), fasting blood glucose, height, homa-b, infant head circumference, ldl cholesterol change with statins, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) ratio percent predicted (in asthmatic participants), obesity with early age of onset (age >2), total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cortex, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood