rs11248850 chr16:113599 G>A
- Sequence
tgggggtctgtgaaaacacttgag[G/A]gagcagataactgggccaaccatg
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) 226LDM (normal breast luminal cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | 0.99 | 0.27 | 1.00 | |||
| 226LDM (normal breast luminal cells) | 1.99 | -0.18 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol, hemoglobin (hb), mean corpuscular hemoglobin (mch), mean corpuscular hemoglobin (mch) among individuals who do not have b-thalassemia, mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), red blood cell count (rbc), red blood cell traits (combined), total cholesterol, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Whole_Blood