rs11915082 chr3:196082268 G>A
- Sequence
tatgcggagggcgctgcgggcgag[G/A]cgaaggccaagggaaaaggcgcca
- ASB in cell types
- adult erythroblasts MM1.S (plasma cell myeloma) monocytes from periferal blood MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line)
- ASB for transcription factors
- RBBP5_HUMAN JUN_HUMAN CDK8_HUMAN SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBBP5_HUMAN | 3.69 | n/a | 2.00 | n/a | n/a | |||
| JUN_HUMAN | 0.50 | 1.77 | 4.50 | n/a | No Hit | |||
| CDK8_HUMAN | 2.37 | -0.91 | 1.00 | n/a | n/a | |||
| SRBP2_HUMAN | 2.47 | n/a | 2.50 | n/a | No Hit | |||
| ZFX_HUMAN | -0.90 | 1.68 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol change with statins, mean corpuscular hemoglobin (mch), mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cortex, Colon_Transverse, Esophagus_Mucosa, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood