rs13289318 chr9:122017043 A>G
- Sequence
tttgcaaatgaagagcagggtaac[A/G]tgggtctccctctttctttaatga
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line) LNCaP C4-2B (prostate carcinoma) GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | -2.31 | 3.48 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 1.64 | -2.80 | 1.33 | |||
| LNCaP C4-2B (prostate carcinoma) | 2.89 | -2.77 | 1.00 | |||
| GM02630 (Fanconi anemi) | -0.49 | 1.52 | 1.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | 1.58 | -0.36 | 1.50 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, hdl cholesterol, ldl cholesterol change with statins, rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood