rs13306561 chr1:11805747 A>G

Sequence
cactaatcccgcgaagggtgcgca[A/G]gggaggcggcagccccccccaaga
ASB in cell types
SUM159PT (Triple negative breast cancer) RMG-1 CD14+ monocytes
ASB for transcription factors
ARI1A_HUMAN
Search SNPs nearby
View in UCSC Genome Browser
View in PheLiGe

Color scale

color scale ref
-log10 FDR of Ref (A) ASB
color scale alt
-log10 FDR of Alt (G) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
ARI1A_HUMAN 2.52 -1.15 5.0·10-31.00 2.00 n/a n/a
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI pulse pressure x alcohol consumption interaction (2df test),  red blood cell folate levels
GRASP adiponectin levels,  advanced age-related macular degeneration,  atrial fibrillation,  comorbid depressive syndrome and alcohol dependence,  coronary artery disease (cad),  diabetic retinopathy in type 2 diabetes mellitus,  diastolic blood pressure (clinic),  diastolic blood pressure (dbp),  diastolic blood pressure (mean 24-hour excluding subjects on antihypertensive treatment),  diastolic blood pressure (mean 24-hour),  homocysteine levels,  n-terminal signal peptide of pro-b-type natriuretic peptide blood level,  systolic blood pressure (sbp),  systolic blood pressure (sbp), 24 hour mean,  systolic blood pressure (sbp), clinic measurements,  total cholesterol change with statins,  waist hip ratio
GTEx eQTL Adipose_Subcutaneous,  Adipose_Visceral_Omentum,  Artery_Tibial,  Brain_Cerebellar_Hemisphere,  Brain_Cerebellum,  Brain_Nucleus_accumbens_basal_ganglia,  Brain_Putamen_basal_ganglia,  Brain_Spinal_cord_cervical_c-1,  Cells_Cultured_fibroblasts,  Cells_EBV-transformed_lymphocytes,  Esophagus_Gastroesophageal_Junction,  Esophagus_Mucosa,  Esophagus_Muscularis,  Muscle_Skeletal,  Pancreas,  Skin_Not_Sun_Exposed_Suprapubic,  Skin_Sun_Exposed_Lower_leg,  Testis,  Thyroid,  Whole_Blood

Download