rs1557351 chr18:57085083 T>C
- Sequence
tccacatgcttaagccagtttgag[T/C]cacttcctgtcacaactgaaagag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) THP-1 (acute monocytic leukemia) MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN IKZF2_HUMAN IKZF1_HUMAN BHE40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.46 | 0.34 | 2.04 | -0.30 | Weak Concordant | |||
| IKZF2_HUMAN | 1.56 | -2.07 | 1.50 | n/a | n/a | |||
| IKZF1_HUMAN | 1.82 | -2.22 | 1.75 | n/a | No Hit | |||
| BHE40_HUMAN | 2.02 | -3.38 | 1.33 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP birth weight, maternal transmission distortion, multiple sclerosis, age of onset, premature ovarian failure, urinary albumin-to-creatinine ratio, years of education
PheWAS abnormal findings on mammogram or breast exam, actinic keratosis, acute laryngitis and tracheitis, acute periodontitis, acute upper respiratory infections, adverse effects of cardiac rhythm regulators, agorophobia, social phobia, and panic disorder, alopecia, back & neck sprains, benign mammary dysplasias, benign neoplasm of unspecified sites, breast cancer, breast cancer, including in situ, cataract, cellulitis and abscess of face, cerebral edema and compression of brain, cholelithiasis, derangement of joint, non-traumatic, diseases of the tongue, essential tremor, exophthalmos, hemorrhoids, hypertrophy of female genital organs, hypotension, hypotension nos, infertility, male, leukemia, lipoprotein disorders, lump or mass in breast, multiple myeloma, nonsenile cataract, osteoarthrosis of multiple sites, other derangement of joint, other dermatoses, other disorders of lipoid metabolism and hyperalimentation, other specified disorders of breast, otosclerosis, pancytopenia, pathological, developmental or recurrent dislocation, poisoning by antibiotics, polyarthropathy or polyarthritis involving multiple sites nos, prostate cancer, renal failure nos, seborrhea, seborrheic keratosis, sinoatrial node dysfunction, substance addiction and disorders, superficial cellulitis and abscess, traumatic arthropathy, urethritis and urethral syndrome, urinary tract infection