rs16881875 chr5:9037931 G>A
- Sequence
tgtgcatggcattcccttttatgc[G/A]tttcttaggtcaaagtgaacattt
- ASB in cell types
- embryonic stem cell-derived pancreatic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| embryonic stem cell-derived pancreatic cells | 0.00 | 1.53 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, autism, bipolar disorder, combined control dataset, total cholesterol