rs17367504 chr1:11802721 A>G
- Sequence
tgtggagggacttttacaggcaac[A/G]gagaagttgcagatcagatgaccc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- NR2C1_HUMAN RAD51_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR2C1_HUMAN | -1.33 | 1.33 | 1.00 | n/a | No Hit | |||
| RAD51_HUMAN | -1.70 | 1.97 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI blood pressure, diastolic blood pressure, diastolic blood pressure (cigarette smoking interaction), mean arterial pressure, pulse pressure, systolic blood pressure, systolic blood pressure (cigarette smoking interaction)
GRASP adiponectin levels, atrial fibrillation, birth weight and systolic blood pressure, comorbid depressive syndrome and alcohol dependence, coronary artery disease (cad), diabetic retinopathy in type 2 diabetes mellitus, diastolic blood pressure (clinic), diastolic blood pressure (dbp), diastolic blood pressure (mean 24-hour excluding subjects on antihypertensive treatment), diastolic blood pressure (mean 24-hour), gene expression of clcn6 in lymphocytes, gene expression of clcn6 in prefrontal cortex, gene expression of mthfr in blood, gene expression of nppa in platelets, hypertension, hypertension (early onset hypertension), ldl cholesterol change with statins, major depressive disorder, mean arterial pressure, n-terminal signal peptide of pro-b-type natriuretic peptide blood level, plamsa n-terminal pro-atrial natriuretic peptide (anp), plasma brain natriuretic peptide (bnp), plasma homocysteine, plasma n-terminal pro-brain natriuretic peptide (bnp), pulse pressure, systolic blood pressure (sbp), systolic blood pressure (sbp) (females), systolic blood pressure (sbp) (males), systolic blood pressure (sbp), 24 hour mean, systolic blood pressure (sbp), clinic measurements, total cholesterol change with statins, waist hip ratio
PheWAS abnormal loss of weight and underweight, abnormal sputum, acquired hypothyroidism, acute sinusitis, anemia of chronic disease, arteritis nos, bladder cancer, bladder cancer and neoplasms, bladder neck obstruction, cardiac dysrhythmias, chronic osteomyelitis, conduct disorders, congenital anomalies of great vessels, congenital pigmentary anomalies of skin, corneal dystrophy, diabetic retinopathy, diseases of nail, disorders of choroid, disorders of sweat glands, effects of radiation nos, endometrial hyperplasia, fluid overload, fracture of tibia and fibula, generalized hyperhidrosis, genitourinary congenital anomalies, gingival and periodontal diseases, hemoptysis, hyperglyceridemia, hyperventilation, idiopathic fibrosing alveolitis, infections of kidney, insomnia, magnesium metabolism disorder, mixed hyperlipidemia, morbid obesity, nephritis and nephropathy without mention of glomerulonephritis, noninflammatory disorders of cervix, open wound of ear, osteochondropathies, other alveolar and parietoalveolar pneumonopathy, other disorders of metabolism, other disorders of prostate, other specified diseases of nail, other specified disorders of plasma protein metabolism, other specified erythematous conditions, pain, swelling or discharge of eye, pelvic inflammatory disease, periodontitis (acute or chronic), peritoneal adhesions (postoperative) (postinfection), phosphorus metabolism disorder, postinflammatory pulmonary fibrosis, postmenopausal hormone replacement, premature menopause and other ovarian failure, pulmonary collapse, interstitial/compensatory emphysema, respiratory abnormalities, retinal hemorrhage/ischemia, senile dementia, subjective visual disturbances, symptomatic menopause, symptoms involving head and neck, symptoms of the muscles, tobacco use disorder, type 2 diabetic retinopathy, unspecified polyarthropathy or polyarthritis, urethral stricture (not specified as infectious), varicose veins of lower extremity, symptomtic, vitamin deficiency
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood