rs176095 chr6:32190542 A>G
- Sequence
ctgggttcaccggcagctcagttc[A/G]tatttcttgttctaatgactcccc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 2.11 | -0.96 | 2.00 | |||
| HCT-116 (colon carcinoma) | 1.15 | 0.92 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), asthma, asthma, childhood onset, asthma, childhood, later and unknown onset, and severe and industrial asthma, asthma, later onset, atopic dermatitis, atopic dermatitis with bronchial asthma, college completion, fasting insulin, height, homa-b, homa-ir, idiopathic membranous nephropathy, intracranial aneurysm, ldl cholesterol, rheumatoid arthritis, rheumatoid arthritis (acpa-positive), total cholesterol, triglycerides, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Kidney_Cortex, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Vagina, Whole_Blood