rs2274432 chr1:184051811 G>A

Sequence
ccggctgcagcggcctgggtccgg[G/A]cggtgttcgcggctttggcgacgg
ASB for transcription factors
CDN1B_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (G) ASB
color scale alt
-log10 FDR of Alt (A) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
CDN1B_HUMAN 1.26 -0.26 0.041.00 1.75 n/a n/a
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI height waist circumference adjusted for bmi (adjusted for smoking behaviour) waist circumference adjusted for bmi (joint analysis main effects and physical activity interaction) waist circumference adjusted for bmi (joint analysis main effects and smoking interaction) waist circumference adjusted for bmi in inactive individuals waist circumference adjusted for bmi in non-smokers waist circumference adjusted for body mass index
GRASP hdl cholesterol height height (adults) ldl cholesterol myopia premature ovarian failure waist hip ratio
PheWAS acute laryngitis and tracheitis acute pharyngitis adrenal hyperfunction adverse effects of sedatives or other central nervous system depressants and anesthetics aneurysm of iliac artery anxiety disorder anxiety, phobic and dissociative disorders aortic aneurysm aphasia/speech disturbance appendiceal conditions appendicitis arthropathy nos atherosclerosis atherosclerosis of native arteries of the extremities with intermittent claudication atherosclerosis of native arteries of the extremities with ulceration or gangrene atherosclerosis of the extremities atrial flutter bipolar brain cancer cancer of brain and nervous system carbohydrate transport and metabolism disorder cardiac dysrhythmias cardiomegaly chronic hepatitis chronic laryngitis chronic obstructive asthma with exacerbation coagulation defects complex regional/central pain syndrome congenital anomalies of limbs cystic kidney disease decubitus ulcer delirium dementia and amnestic disorders delirium due to conditions classified elsewhere depression disaccharide malabsorption diseases of the oral soft tissues disorders of coccyx disorders of fluid, electrolyte, and acid-base balance disorders of function of stomach disturbance of salivary secretion edema electrolyte imbalance fractur of unspecified part of femur fracture of clavicle or scapula fracture of unspecified bones heart valve disorders hemorrhage nos hemorrhagic disorder due to intrinsic circulating anticoagulants hydronephrosis hyposmolality and/or hyponatremia hypovolemia infection/inflammation of internal prosthetic device, implant or graft iron metabolism disorder joint effusions lack of coordination liver abscess and sequelae of chronic liver disease macular puckering of retina mood disorders morbid obesity multiple myeloma noninflammatory disorders of vulva and perineum noninflammatory female genital disorders nonrheumatic pulmonary valve disorders nonspecific findings on examination of blood nontoxic multinodular goiter nontoxic uninodular goiter occlusion of cerebral arteries open-angle glaucoma other disorders of arteries and arterioles other disorders of metabolic, endocrine, immunity disorders other specified cardiac dysrhythmias parkinsons disease peptic ulcer peripheral arterial disease peripheral vascular disease pituitary hypofunction poisoning by water, mineral, and uric acid metabolism drugs primary thrombocytopenia prurigo pulmonary collapse interstitial/compensatory emphysema secondary malignancy of brain/spine sensorineural hearing loss stress fracture stricture of artery superficial cellulitis and abscess thoracic neuritis/radiculitis ulceration of intestine ulceration of the lower gi tract unspecified erythematous condition varicose veins of lower extremity, symptomtic vascular disorders of penis
GTEx eQTL Adipose_Subcutaneous Adipose_Visceral_Omentum Adrenal_Gland Artery_Aorta Artery_Tibial Brain_Amygdala Brain_Anterior_cingulate_cortex_BA24 Brain_Caudate_basal_ganglia Brain_Cerebellar_Hemisphere Brain_Cerebellum Brain_Frontal_Cortex_BA9 Brain_Hippocampus Brain_Hypothalamus Brain_Nucleus_accumbens_basal_ganglia Breast_Mammary_Tissue Cells_Cultured_fibroblasts Esophagus_Gastroesophageal_Junction Esophagus_Muscularis Lung Nerve_Tibial Thyroid Whole_Blood

Download