Attention! You are using release Bill Cipher. You can switch to the latest ADASTRA version: adastra.autosome.org

rs261360 chr20:5057128 G>A

Sequence
ttccttctcatgggagcactcccc[G/A]aagacatcacgtgcagctgaatcc
ASB in cell types
MDM(monocyte derived macrophages) macrophages form periferal blood

Color scale

color scale ref
-log10 FDR of Ref (G) ASB
color scale alt
-log10 FDR of Alt (A) ASB

Details

Cell type
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
MDM(monocyte derived macrophages) 1.61 -0.20 0.011.00 2.00
macrophages form periferal blood 1.78 0.00 0.041.00 2.00
Items per page:
1 – 2 of 2

Motif analysis

No data available

Genetic associations

EMBL-EBI hair morphology
GRASP arthritis including non-rheumatoid hair morphology longstanding arthritis rheumatoid arthritis schizophrenia triglycerides change with statins waist hip ratio
PheWAS abnormal findings examination of lungs abnormal involuntary movements abnormal kidney function acute and chronic tonsillitis acute pharyngitis acute tonsillitis allergic reaction to food anisometropia anomalies of tooth position/malocclusion anticoagulants causing adverse effects astigmatism benign neoplasm of breast cancer of other female genital organs cataract chronic cystitis chronic renal failure congenital anomalies of intestine congenital cataract and lens anomalies congenital pigmentary anomalies of skin corneal degenerations cysts of the jaws dental caries diseases of hard tissues of teeth disorders of adrenal glands disorders of function of stomach disorders of menstruation disorders of the autonomic nervous system empyema and pneumothorax esophageal cancer generalized anxiety disorder heart valve disorders hydrocele hypocalcemia hypothyroidism infection/inflammation of internal prosthetic device, implant or graft infections of kidney irregular menstrual bleeding mental retardation muscle weakness myoclonus neck pain nonrheumatic aortic valve disorders optic atrophy other congenital anomalies of skin other disorders of bone and cartilage other disorders of testis other paralytic syndromes other specified diseases of sebaceous glands other specified disorders of breast other specified osteoporosis ovarian cancer palpitations peritonitis and retroperitoneal infections pneumococcal pneumonia pneumonitis due to inhalation of food or vomitus poisoning by agents primarily affecting blood constituents rash and other nonspecific skin eruption renal failure retention of urine sepsis sepsis and sirs skin neoplasm of uncertain behavior spirochetal infection spontaneous ecchymoses subarachnoid hemorrhage systemic lupus erythematosus urticaria
GTEx eQTL Adipose_Subcutaneous Adipose_Visceral_Omentum Adrenal_Gland Artery_Aorta Artery_Coronary Artery_Tibial Brain_Cerebellar_Hemisphere Brain_Cortex Brain_Putamen_basal_ganglia Breast_Mammary_Tissue Cells_Cultured_fibroblasts Colon_Sigmoid Colon_Transverse Esophagus_Gastroesophageal_Junction Esophagus_Mucosa Esophagus_Muscularis Heart_Atrial_Appendage Heart_Left_Ventricle Lung Minor_Salivary_Gland Muscle_Skeletal Nerve_Tibial Ovary Pancreas Pituitary Prostate Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Small_Intestine_Terminal_Ileum Spleen Stomach Testis Thyroid Uterus Vagina Whole_Blood

Download