rs261360 chr20:5057128 G>A
- Sequence
ttccttctcatgggagcactcccc[G/A]aagacatcacgtgcagctgaatcc
- ASB in cell types
- MDM(monocyte derived macrophages) macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 1.61 | -0.20 | 2.00 | |||
| macrophages form periferal blood | 1.78 | 0.00 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, hair morphology, longstanding arthritis, rheumatoid arthritis, schizophrenia, triglycerides change with statins, waist hip ratio
PheWAS abnormal findings examination of lungs, abnormal involuntary movements, abnormal kidney function, acute and chronic tonsillitis, acute pharyngitis, acute tonsillitis, allergic reaction to food, anisometropia, anomalies of tooth position/malocclusion, anticoagulants causing adverse effects, astigmatism, benign neoplasm of breast, cancer of other female genital organs, cataract, chronic cystitis, chronic renal failure, congenital anomalies of intestine, congenital cataract and lens anomalies, congenital pigmentary anomalies of skin, corneal degenerations, cysts of the jaws, dental caries, diseases of hard tissues of teeth, disorders of adrenal glands, disorders of function of stomach, disorders of menstruation, disorders of the autonomic nervous system, empyema and pneumothorax, esophageal cancer, generalized anxiety disorder, heart valve disorders, hydrocele, hypocalcemia, hypothyroidism, infection/inflammation of internal prosthetic device, implant or graft, infections of kidney, irregular menstrual bleeding, mental retardation, muscle weakness, myoclonus, neck pain, nonrheumatic aortic valve disorders, optic atrophy, other congenital anomalies of skin, other disorders of bone and cartilage, other disorders of testis, other paralytic syndromes, other specified diseases of sebaceous glands, other specified disorders of breast, other specified osteoporosis, ovarian cancer, palpitations, peritonitis and retroperitoneal infections, pneumococcal pneumonia, pneumonitis due to inhalation of food or vomitus, poisoning by agents primarily affecting blood constituents, rash and other nonspecific skin eruption, renal failure, retention of urine, sepsis, sepsis and sirs, skin neoplasm of uncertain behavior, spirochetal infection, spontaneous ecchymoses, subarachnoid hemorrhage, systemic lupus erythematosus, urticaria
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Vagina, Whole_Blood