rs262121 chr6:142518361 T>C
- Sequence
tggcagggtgatgaaatggactct[T/C]tgatggaccctagcttcagtggtt
- ASB in cell types
- CTR (Rhabdomyosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTR (Rhabdomyosarcoma) | 2.25 | -2.46 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, bipolar disorder, cystatin c in serum, diastolic blood pressure (dbp), fasting insulin, height, lung function, forced expiratory volume in 1 second (fev1), lung function, predicted ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), obesity with early age of onset (age >2), tardive dyskinesia, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg