rs26232 chr5:103261019 C>T
- Sequence
ctgtcggtcatatttgcagtgaaa[C/T]tgagtatttttctaaaagtagaag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- MEF2B_HUMAN ZN217_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 0.91 | -0.91 | 1.00 | n/a | No Hit | |||
| ZN217_HUMAN | 2.09 | -1.79 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP joint damage severity in rheumatoid arthritis, partial epilepsy, primary biliary cirrhosis, rheumatoid arthritis, years of education
PheWAS abdominal aortic aneurysm, abnormal cytological, histological, immunological and dna test findings, abnormal glucose, abnormal loss of weight and underweight, acute upper respiratory infections, adrenal hypofunction, adverse drug events and drug allergies, adverse effects of opiates and related narcotics in therapeutic use, aortic aneurysm, benign neoplasm of thyroid glands, cellulitis and abscess of face, cellulitis and abscess of hand/fingers, cholecystitis without cholelithiasis, chronic pancreatitis, congenital anomalies of lower limb, including pelvic girdle, dermatophytosis, dermatophytosis / dermatomycosis, dermatophytosis of nail, diseases of esophagus, diseases of sebaceous glands, disorders of adrenal glands, disorders of lacrimal system, dysmetabolic syndrome x, dyspareunia, emphysema, esophagitis, gerd and related diseases, gastrointestinal hemorrhage, generalized convulsive epilepsy, gerd, hepatic cancer, primary, hydronephrosis, iatrogenic hypotension, impaired fasting glucose, inguinal hernia, keratitis, mental retardation, mycoses, neck pain, open wound of eye or eyelid, open wound of lip and mouth, open wounds of head, neck, and trunk, otalgia, other aneurysm, other disorders of eyelids, other disorders of metabolism, other local infections of skin and subcutaneous tissue, pernicious anemia, seborrheic keratosis, sensorineural hearing loss, sicca syndrome, symptoms involving female genital tract, synoviopathy, unspecified local infection of skin and subcutaneous tissue, unspecified osteomyelitis, urinary tract infection, vaginitis and vulvovaginitis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood