rs2697668 chr8:89882782 A>G
- Sequence
cattgtaactggtccaggtatggc[A/G]aaatccatcagcctaggcagaggc
- ASB in cell types
- T47D (invasive ductal carcinoma) BEAS-2B (bronchial epithelium) HS-SY-2(Monophasic synovial sarcoma) pancreas
- ASB for transcription factors
- CTCF_HUMAN PRGR_HUMAN GCR_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.03 | 2.14 | 1.23 | n/a | No Hit | |||
| PRGR_HUMAN | 0.29 | 1.51 | 1.11 | n/a | No Hit | |||
| GCR_HUMAN | -0.16 | 2.23 | 1.08 | n/a | No Hit | |||
| SMCA4_HUMAN | -0.13 | 1.69 | 1.45 | n/a | n/a | |||
| FOXA1_HUMAN | 0.37 | 1.25 | 1.64 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, barnes akathisia rating scale, hypertension (early onset hypertension), simpson-angus scale
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Atrial_Appendage, Liver, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood