Attention! You are using release Bill Cipher. You can switch to the latest ADASTRA version: adastra.autosome.org

rs339331 chr6:116888889 T>C

Sequence
gcatgaactctctctccccagttt[T/C]atgaggtttatctttagtgactag
ASB in cell types
22RV1 (prostate carcinoma) LHSAR (prostate epithelial cells) prostate tumor
ASB for transcription factors
HXB13_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (T) ASB
color scale alt
-log10 FDR of Alt (C) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
HXB13_HUMAN 2.55 -0.10 3.7·10-41.00 1.62 -4.27 Concordant
Items per page:
1 – 1 of 1

Motif analysis

HXB13_HUMAN Concordant
HXB13_HUMAN pic

Genetic associations

EMBL-EBI prostate cancer
GRASP diastolic blood pressure (dbp) fasting blood glucose ldl cholesterol maternal transmission distortion prostate cancer prostate cancer (advanced prostate cancer) prostate cancer (non-advanced prostate cancer) salmonella-induced pyroptosis serum creatinine total cholesterol
PheWAS abnormal chest sounds abnormal findings on examination of urine abnormal glucose abnormal involuntary movements abnormal kidney function abnormal serum enzyme levels acquired deformities of finger acquired deformities of limbs acquired toe deformities acute periodontitis acute sinusitis antihypertensive agents causing adverse effects asthma atherosclerosis of native arteries of the extremities with ulceration or gangrene benign neoplasm of skin benign neoplasm of uterus blister bronchitis bursitis cancer of mouth cancer of oropharynx cancer within the respiratory system carditis cerebral edema and compression of brain cervical radiculitis chronic airway obstruction chronic bronchitis chronic lymphocytic thyroiditis chronic osteomyelitis chronic periodontitis chronic pharyngitis and nasopharyngitis chronic ulcer of leg or foot chronic ulcer of skin clotting factor deficiency congenital anomalies of urinary system cystic kidney disease disorders of lipoid metabolism disorders of other cranial nerves disorders of vitreous body duodenal ulcer eating disorder elevated c-reactive protein erectile dysfunction exostosis of jaw fever of unknown origin genital prolapse gingival and periodontal diseases glaucoma gram negative septicemia hallux valgus (bunion) hemiplegia herpes zoster hyperbilirubinemia hypercholesterolemia hyperlipidemia hypotony of eye impaired fasting glucose infection/inflammation of internal prosthetic device, implant or graft infections involving bone inflammatory and toxic neuropathy intestinal infection intestinal malabsorption nos keratoderma, acquired light-headedness and vertigo loss of teeth or edentulism lung cancer macular degeneration mastoiditis neoplasm of uncertain behavior nervous system congenital anomalies nonrheumatic mitral valve disorders occlusion and stenosis of precerebral arteries osteomyelitis other abnormal glucose other and unspecified disc disorder other derangement of joint other dermatoses other diseases of the teeth and supporting structures other hypertrophic and atrophic conditions of skin other paralytic syndromes pericarditis periodontitis (acute or chronic) peripheral vascular disease pityriasis poisoning by psychotropic agents prostate cancer pseudoexfoliation glaucoma respiratory failure insufficiency arrest retinoschisis and retinal cysts schizophrenia and other psychotic disorders seborrheic keratosis somatoform disorder stomach cancer subjective visual disturbances symptoms involving female genital tract thyroiditis tinnitus trigeminal nerve disorders tuberculosis urethral hypermobility/isd vertiginous syndromes and other disorders of vestibular system viral infection
GTEx eQTL Adipose_Subcutaneous

Download