rs342275 chr7:106718770 C>T
- Sequence
catttcattatcatttttcagata[C/T]gtgactcaagttaccaagttgcca
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | -1.32 | 1.91 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
PheWAS abnormal findings on radiological breast exam, acute posthemorrhagic anemia, arthropathy associated with infections, benign neoplasm of thyroid glands, cancer of other female genital organs, cellulitis and abscess of face, cellulitis and abscess of hand/fingers, cellulitis and abscess of trunk, cerebral aneurysm, cholecystitis without cholelithiasis, chronic laryngitis, congenital anomalies of intestine, corneal degenerations, corneal opacity, cyst or abscess of bartholins gland, cystoid macular degeneration of retina, dementia with cerebral degenerations, dermatomyositis and polymyositis, diffuse diseases of connective tissue, diseases of the jaws, duodenitis, dupuytrens disease, dysthymic disorder, exophthalmos, fasciitis, generalized convulsive epilepsy, giant cell arteritis, gout, gout and other crystal arthropathies, heart transplant/surgery, hydronephrosis, inflammation of the eye, intracerebral hemorrhage, irregular menstrual cycle, irregular menstrual cycle/bleeding, macular degeneration, dry, malaise and fatigue, nephritis and nephropathy without mention of glomerulonephritis, nonsenile cataract, osteitis deformans and osteopathies associated with other disorders, osteoarthrosis, localized, primary, other headache syndromes, other specified disorders of plasma protein metabolism, other unspecified back disorders, pagets disease of bone, painful respiration, pancreatic cancer, pituitary hyperfunction, pneumonitis due to inhalation of food or vomitus, poisoning by antibiotics, posterior pituitary disorders, reflux esophagitis, sensorineural hearing loss, speech and language disorder, superficial cellulitis and abscess, syncope and collapse, systemic sclerosis, temporomandibular joint disorders, tension headache