Attention! You are using release Bill Cipher. You can switch to the latest ADASTRA version: adastra.autosome.org

rs342275 chr7:106718770 C>T

Sequence
catttcattatcatttttcagata[C/T]gtgactcaagttaccaagttgcca
ASB in cell types
GM23248

Color scale

color scale ref
-log10 FDR of Ref (C) ASB
color scale alt
-log10 FDR of Alt (T) ASB

Details

Cell type
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
GM23248 -1.32 1.91 1.000.03 1.00
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI platelet count
GRASP ldl cholesterol platelet count (plt) serum creatinine total cholesterol triglycerides
PheWAS abnormal findings on radiological breast exam acute posthemorrhagic anemia arthropathy associated with infections benign neoplasm of thyroid glands cancer of other female genital organs cellulitis and abscess of face cellulitis and abscess of hand/fingers cellulitis and abscess of trunk cerebral aneurysm cholecystitis without cholelithiasis chronic laryngitis congenital anomalies of intestine corneal degenerations corneal opacity cyst or abscess of bartholins gland cystoid macular degeneration of retina dementia with cerebral degenerations dermatomyositis and polymyositis diffuse diseases of connective tissue diseases of the jaws duodenitis dupuytrens disease dysthymic disorder exophthalmos fasciitis generalized convulsive epilepsy giant cell arteritis gout gout and other crystal arthropathies heart transplant/surgery hydronephrosis inflammation of the eye intracerebral hemorrhage irregular menstrual cycle irregular menstrual cycle/bleeding macular degeneration, dry malaise and fatigue nephritis and nephropathy without mention of glomerulonephritis nonsenile cataract osteitis deformans and osteopathies associated with other disorders osteoarthrosis localized, primary other headache syndromes other specified disorders of plasma protein metabolism other unspecified back disorders pagets disease of bone painful respiration pancreatic cancer pituitary hyperfunction pneumonitis due to inhalation of food or vomitus poisoning by antibiotics posterior pituitary disorders reflux esophagitis sensorineural hearing loss speech and language disorder superficial cellulitis and abscess syncope and collapse systemic sclerosis temporomandibular joint disorders tension headache
Finemapping platelet counts

Download