rs4227 chr17:7587859 G>T

Sequence
cctctagcagcaatttccagctgt[G/T]taacactatcctgggcaaatgttt
ASB in cell types
BEAS-2B (bronchial epithelium)
ASB for transcription factors
GCR_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (G) ASB
color scale alt
-log10 FDR of Alt (T) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
GCR_HUMAN 1.31 -0.01 0.041.00 1.00 n/a No Hit
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI iga nephropathy
GRASP asthma circulating sex hormone-binding globulin levels circulating sex hormone-binding globulin levels in non-postmenopausal hormone users circulating sex hormone-binding globulin levels in postmenopausal hormone users cystatin c in serum diastolic blood pressure (dbp) eye color fasting insulin homa-b iga nephropathy ldl cholesterol serum dihydrotestosterone (dht) level serum dihydrotestosterone level in dutasteride or placebo treatment group serum dihydrotestosterone level in dutasteride treatment group serum dihydrotestosterone level in placebo group serum testosterone (t) level serum testosterone (t) level in dutasteride or placebo treatment group serum testosterone (t) level in dutasteride treatment group serum testosterone (t) level in placebo group sex hormone-binding globulin (shbg) (nmol/l)
PheWAS acute pharyngitis allergic rhinitis antihypertensive agents causing adverse effects brain cancer bronchitis cancer of brain and nervous system cellulitis and abscess of trunk chorioretinal scars concussion conduct disorders conjunctivitis, infectious costochondritis diseases of sebaceous glands diseases of spleen disorders of cervical region disorders of mineral metabolism dyshidrosis dyspepsia and disorders of function of stomach dysphagia endometrial hyperplasia essential tremor fracture of hand or wrist hypercalcemia hyperventilation infection of the eye infertility, male insect bite loose body in joint male genital disorders malignant neoplasm of brain and nervous system menieres disease multiple myeloma myeloid leukemia nasal polyps nerve plexus lesions oliguria and anuria open wounds of head neck and trunk other nonspecific findings on examination of urine otitis externa paralysis/spasm of vocal cords or larynx pneumococcal pneumonia posttraumatic wound infection premenstrual tension syndromes pruritus and related conditions renal failure nos sebaceous cyst secondary malignant neoplasm of digestive systems subarachnoid hemorrhage swelling, mass, or lump in head and neck symptoms involving head and neck temporomandibular joint disorder nos ulceration of the lower gi tract upper gastrointestinal congenital anomalies urinary complications vaginal enterocele, congenital or acquired valvular heart disease/ heart chambers visual field defects
GTEx eQTL Adipose_Subcutaneous Adrenal_Gland Brain_Cerebellar_Hemisphere Brain_Cerebellum Brain_Cortex Brain_Spinal_cord_cervical_c-1 Cells_Cultured_fibroblasts Esophagus_Mucosa Esophagus_Muscularis Heart_Atrial_Appendage Muscle_Skeletal Spleen Stomach Whole_Blood

Download