rs4227 chr17:7587859 G>T
- Sequence
cctctagcagcaatttccagctgt[G/T]taacactatcctgggcaaatgttt
- ASB in cell types
- BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 1.31 | -0.01 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, circulating sex hormone-binding globulin levels, circulating sex hormone-binding globulin levels in non-postmenopausal hormone users, circulating sex hormone-binding globulin levels in postmenopausal hormone users, cystatin c in serum, diastolic blood pressure (dbp), eye color, fasting insulin, homa-b, iga nephropathy, ldl cholesterol, serum dihydrotestosterone (dht) level, serum dihydrotestosterone level in dutasteride or placebo treatment group, serum dihydrotestosterone level in dutasteride treatment group, serum dihydrotestosterone level in placebo group, serum testosterone (t) level, serum testosterone (t) level in dutasteride or placebo treatment group, serum testosterone (t) level in dutasteride treatment group, serum testosterone (t) level in placebo group, sex hormone-binding globulin (shbg) (nmol/l)
PheWAS acute pharyngitis, allergic rhinitis, antihypertensive agents causing adverse effects, brain cancer, bronchitis, cancer of brain and nervous system, cellulitis and abscess of trunk, chorioretinal scars, concussion, conduct disorders, conjunctivitis, infectious, costochondritis, diseases of sebaceous glands, diseases of spleen, disorders of cervical region, disorders of mineral metabolism, dyshidrosis, dyspepsia and disorders of function of stomach, dysphagia, endometrial hyperplasia, essential tremor, fracture of hand or wrist, hypercalcemia, hyperventilation, infection of the eye, infertility, male, insect bite, loose body in joint, male genital disorders, malignant neoplasm of brain and nervous system, menieres disease, multiple myeloma, myeloid leukemia, nasal polyps, nerve plexus lesions, oliguria and anuria, open wounds of head, neck, and trunk, other nonspecific findings on examination of urine, otitis externa, paralysis/spasm of vocal cords or larynx, pneumococcal pneumonia, posttraumatic wound infection, premenstrual tension syndromes, pruritus and related conditions, renal failure nos, sebaceous cyst, secondary malignant neoplasm of digestive systems, subarachnoid hemorrhage, swelling, mass, or lump in head and neck, symptoms involving head and neck, temporomandibular joint disorder nos, ulceration of the lower gi tract, upper gastrointestinal congenital anomalies, urinary complications, vaginal enterocele, congenital or acquired, valvular heart disease/ heart chambers, visual field defects
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Spleen, Stomach, Whole_Blood