rs6089829 chr20:63037684 A>G
- Sequence
actccaaacagaaaccctgtctcc[A/G]tgaataacaactacccattcctct
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) K562 (myelogenous leukemia)
- ASB for transcription factors
- SPT5H_HUMAN NR2C1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPT5H_HUMAN | -3.97 | 3.23 | 1.50 | n/a | n/a | |||
| NR2C1_HUMAN | n/a | 0.90 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hip bone mineral density (bmd), irritible bowel syndrome, late onset alzheimers disease, neuroblastoma (brain cancer), parkinsons disease, spine bone mineral density (bmd), total cholesterol, triglycerides
PheWAS abnormal findings on radiological examination intrathoracic organs, abnormal results of function studies, acute prostatitis, adrenal hypofunction, adverse effects of opiates and related narcotics in therapeutic use, apnea, ascites (non malignant), bacteremia, calcaneal spur, exostosis nos, cardiac arrest & ventricular fibrillation, cardiac pacemaker in situ, cardiac pacemaker/device in situ, celiac disease, chondrocalcinosis, conjunctivitis, infectious, crystal arthropathies, decreased libido, diseases of nail, effects of radiation nos, failure to thrive, hypoventilation, lack of normal physiological development, malaise and fatigue, mechanical complication due to other implant and internal device, muscle/tendon sprain, muscular dystrophies and other myopathies, noninfectious disorders of lymphatic channels, nonrheumatic pulmonary valve disorders, open wound of foot except toe(s) alone, open wound of toe(s), osteochondropathies, other abnormal blood chemistry, other disorders of adrenal glands, other disorders of ear, other symptoms referable to back, pituitary hyperfunction, pityriasis, pneumococcal pneumonia, psychogenic disorder, random mental disorder. ignored for now, restless legs syndrome, second degree av block, sleep related movement disorders, stress fracture, subdural hemorrhage, vascular complications of surgery and medical procedures