rs6435862 chr2:214807822 G>T

Sequence
ctgaccacagtctaagtgaagccc[G/T]atgcttccacataggtatgtgcca
ASB in cell types
GM12878 (female B-cells lymphoblastoid cell line)
ASB for transcription factors
FOXK2_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (G) ASB
color scale alt
-log10 FDR of Alt (T) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
FOXK2_HUMAN n/a 2.51 1.000.03 1.50 n/a n/a
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI neuroblastoma (high-risk)
GRASP college completion high-risk neuroblastoma irritible bowel syndrome ldl cholesterol low-intermediate risk neuroblastoma neuroblastoma neuroblastoma (brain cancer) total cholesterol triglycerides
PheWAS acute pericarditis acute pharyngitis acute posthemorrhagic anemia acute prostatitis anemia nos anomalies of pupillary function bacterial enteritis cancer, suspected or other cellulitis and abscess of arm cholelithiasis cholelithiasis and cholecystitis chorioretinal scars chronic lymphocytic thyroiditis chronic prostatitis complications of transplants and reattached limbs corneal edema cysts of the jaws diseases of lips diseases of respiratory system disorders of choroid diverticulum of esophagus, acquired dyshidrosis effects of radiation nos first degree av block fracture of hand or wrist fracture of tibia and fibula hydrocele hyperplasia of prostate inflammatory diseases of prostate intestinal infection lung disease due to external agents macular degeneration, dry macular puckering of retina menieres disease myasthenia gravis myoneural disorders non-melanoma skin cancer noninflammatory disorders of cervix nonsenile cataract open wound of ear other anemias other cells and casts in urine other disorders of ear other disorders of prostate other disorders of tympanic membrane other endocrine disorders other headache syndromes other unspecified back disorders otitis media perforation of tympanic membrane peripheral or central vertigo peritoneal or intestinal adhesions photodermatitis & sunburn pneumococcal pneumonia pneumoconiosis premature menopause and other ovarian failure prostatitis pruritus and related conditions redundant prepuce and phimosis/bxo respiratory failure insufficiency arrest retention of urine schizophrenia and other psychotic disorders sexual and gender identity disorders sicca syndrome skin cancer suppurative and unspecified otitis media symptoms involving respiratory system temporomandibular joint disorder nos testicular dysfunction testicular hypofunction vitamin b-complex deficiencies vitamin deficiency
GTEx eQTL Adipose_Subcutaneous Adipose_Visceral_Omentum Adrenal_Gland Artery_Aorta Artery_Coronary Artery_Tibial Brain_Caudate_basal_ganglia Brain_Cerebellum Brain_Cortex Brain_Frontal_Cortex_BA9 Brain_Hippocampus Brain_Hypothalamus Brain_Nucleus_accumbens_basal_ganglia Brain_Putamen_basal_ganglia Breast_Mammary_Tissue Cells_Cultured_fibroblasts Cells_EBV-transformed_lymphocytes Colon_Sigmoid Colon_Transverse Esophagus_Gastroesophageal_Junction Esophagus_Mucosa Esophagus_Muscularis Heart_Atrial_Appendage Heart_Left_Ventricle Lung Minor_Salivary_Gland Nerve_Tibial Ovary Pancreas Pituitary Prostate Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Small_Intestine_Terminal_Ileum Spleen Stomach Testis Thyroid Uterus Whole_Blood

Download