rs6478109 chr9:114806486 A>G
- Sequence
ggatgagaggtgtgtggtttgcag[A/G]ttgggaaacggaaatcacatttgc
- ASB in cell types
- germinal center B-cells
- ASB for transcription factors
- CBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CBP_HUMAN | n/a | 1.94 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, birth weight, crohns disease, irritible bowel syndrome, pediatric inflammatory bowel disease, plasma renin activity, sporadic creutzfeldt-jakob disease, stabilized warfarin dose, tetrology of fallot, ulcerative colitis, vitiligo
PheWAS acne, arthropathy nos, aseptic necrosis of bone, benign neoplasm of other parts of digestive system, breast cancer, breast cancer, including in situ, bronchiectasis, bullous dermatoses, calculus of lower urinary tract, cancer of kidney and renal pelvis, cancer of kidney and urinary organs, cancer of larynx, cancer of other male genital organs, cancer of the upper aerodigestive tract, cardiomegaly, cholangitis, chorioretinal scars, cns infection and poliomyelitis, complications of gastrostomy, colostomy and enterostomy, congenital anomalies of peripheral vascular system, diseases of blood and blood-forming organs, diseases of sebaceous glands, disorders of cornea, disorders of diaphragm, disorders of other cranial nerves, diverticulum of esophagus, acquired, elevated prostate specific antigen, eosinophilia, glaucoma, hemorrhagic disorder due to intrinsic circulating anticoagulants, hypotension, lesions of stomach and duodenum, localized superficial swelling, mass, or lump, lung disease due to external agents, macular degeneration, macular degeneration, dry, malignant neoplasm of kidney and other urinary organs, mammographic microcalcification, non-healing surgical wound, orthostatic hypotension, other arthropathies, other disorders of bone and cartilage, other disorders of prostate, other dyschromia, other specified diseases of sebaceous glands, paralytic ileus, perforation of tympanic membrane, pituitary hyperfunction, polymyalgia rheumatica, primary angle-closure glaucoma, primary open angle glaucoma, renal cell carcinoma, retinal detachments and defects, retinal disorders, sarcoidosis, seborheic dermatitis, secondary hyperparathyroidism (of renal origin), stress incontinence, female, symptoms associated with female genital organs, toxic effect of venom, tuberculosis, urinary tract infection, uterine cancer, uterine/uterovaginal prolapse, visual field defects