rs6482743 chr10:129658915 A>G
- Sequence
aagctgtagcattcaaggcctccc[A/G]ggtgtcgctgtaatttcttgtata
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 3.36 | n/a | 1.33 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -0.01 | 1.54 | 1.12 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 1.84 | -1.52 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 2.24 | -0.45 | 1.33 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 1.60 | -1.41 | 1.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP birth weight, chronic kidney disease, hip bone mineral density (bmd), mitral annular calcium, spine bone mineral density (bmd), variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood