rs7544736 chr1:96698787 A>G
- Sequence
gttttctttgtgtttatcaggctt[A/G]atgttatttgagttctgggatctg
- ASB in cell types
- BE2C
- ASB for transcription factors
- HAND2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HAND2_HUMAN | 2.40 | -4.28 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
PheWAS abdominal hernia, anemia in neoplastic disease, anterior pituitary disorders, aphakia and other disorders of lens, aseptic necrosis of bone, barretts esophagus, benign neoplasm of respiratory and intrathoracic organs, cardiac arrest, deficiency anemias nos, derangement of joint, non-traumatic, diaphragmatic hernia, diseases of blood and blood-forming organs, disorders of optic nerve and visual pathways, dysthymic disorder, epiphora, generalized convulsive epilepsy, genu valgum or varum (acquired), gram positive septicemia, hearing loss, hemiplegia, herpes zoster with nervous system complications, hyperosmolality and/or hypernatremia, hypersomnia, hypertensive heart and/or renal disease, hypertensive heart disease, hypoventilation, insect bite, iron metabolism disorder, joint effusions, kidney replaced by transpant, meningitis, mixed hyperlipidemia, oliguria and anuria, open wound of hand except finger(s), optic neuritis/neuropathy, osteoarthrosis, osteoarthrosis nos, other congenital anomalies of skin, other derangement of joint, other disorders of arteries and arterioles, other disorders of bone and cartilage, other disorders of eye, other disorders of intestine, pernicious or b12 deficiency anemia, phlebitis and thrombophlebitis of lower extremities, proteinuria, pyogenic granuloma, renal colic, stricture of artery, throat pain, toxic effect of venom, transient alteration of awareness, ulcer of esophagus, urethral stricture (not specified as infectious)