rs7864648 chr9:16368734 G>T

Sequence
ttttacactggaagaaactgagaa[G/T]caaactggtaacttgcccaaggtc
ASB in cell types
BEAS-2B (bronchial epithelium)
ASB for transcription factors
GCR_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (G) ASB
color scale alt
-log10 FDR of Alt (T) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
GCR_HUMAN 1.34 0.62 0.010.99 1.00 n/a No Hit
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

GRASP height infant head circumference irritible bowel syndrome longstanding arthritis rheumatoid arthritis schizophrenia sporadic creutzfeldt-jakob disease variant creutzfeldt-jakob disease
PheWAS abnormal electrocardiogram abnormal serum enzyme levels abnormal sputum acne acquired absence of breast alcohol-related disorders alcoholism aphakia and other disorders of lens benign neoplasm of other parts of digestive system benign neoplasm of respiratory and intrathoracic organs cardiac arrest cardiac arrest & ventricular fibrillation cardiac conduction disorders cardiac dysrhythmias cardiomegaly cellulitis and abscess of arm chronic hepatitis circumscribed scleroderma complex regional/central pain syndrome complications of transplants and reattached limbs contracture of joint cornea replaced by transplant costochondritis decreased libido dementia with cerebral degenerations digestive congenital anomalies disorders of choroid disorders of mineral metabolism elevated blood pressure reading esophageal atresia/tracheoesophageal fistula essential hypertension femoral hernia hemoptysis hypercalcemia hypertension ileostomy status iron metabolism disorder joint/ligament sprain mastoiditis methicillin resistant staphylococcus aureus muscular wasting and disuse atrophy nephritis and nephropathy in diseases classified elsewhere nephritis and nephropathy without mention of glomerulonephritis nephritis nephrosis renal sclerosis nonsenile cataract obesity open wounds of extremities optic atrophy other dyschromia other specified cardiac dysrhythmias pityriasis posttraumatic stress disorder posttraumatic wound infection premature beats pseudoexfoliation glaucoma sexually transmitted infections supraventricular premature beats type 1 diabetic retinopathy upper gastrointestinal congenital anomalies uterine cancer viral pneumonia

Download